Economy & Finance

R Tranilast enhances the anti-tumor effects of tamoxifen on human breast cancer cells in vitro

Description
R Tranilast enhances the anti-tumor effects of tamoxifen on human breast cancer cells in vitro
Published
of 13
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Share
Transcript
  RESEARCH Open Access  Tranilast enhances the anti-tumor effects of tamoxifen on human breast cancer cells  in vitro Sara Darakhshan 1 and Ali Ghanbari 2* A correction to this article has been published: http://www.jbiomedsci.com/content/20/1/89 Abstract Background:  Tamoxifen is the most widely used anti-estrogen for the treatment of breast cancer. Studies showthat the combination therapy with other substances that helps the activity of tamoxifen. The objective of this studywas to evaluate the effect of tamoxifen when used in combination with tranilast on human breast cancer cells. Results:  Two MCF-7 and MDA-MB-231 human breast cancer cell lines were treated with tamoxifen and/or tranilast. The cell viability and cytotoxicity was assessed using MTT and LDH assays; the apoptotic effects were examined by TUNEL assay, acridine orange/ethidium bromide staining and DNA laddering, also the expression levels of bax andbcl-2 genes were detected by real-time RT-PCR. The mRNA expression of TGF- β  ligands and receptors examinedusing real-time RT-PCR and TGF- β 1 protein secretion levels were also evaluated by ELISA assay. Inhibitory effect of these drugs on invasion and metastasis were tested by wound healing and matrigel invasion assay.We found that combination of these drugs led to a marked increase in growth and proliferation inhibitioncompared to either agent alone. Furthermore, bax and bcl-2 affected by tamoxifen and/or tranilast and resulted ina significant increase in bax and decrease in bcl-2 mRNA expression. In addition, treatment with tamoxifen and/ortranilast resulted in significant decreased in TGF- β 1, 2, 3, TGF- β RI and II mRNA and TGF- β 1 protein levels while TGF- β RIII mRNA level was increased and invasion was also inhibited. Conclusions:  These findings indicate that tranilast, by synergistic effect, enhances the activity of tamoxifen and the TGF- β  pathway is a target for this combination therapy, therefore; we propose that this combined treatment maybe suitable selection in prevention of breast cancer. Keywords:  Breast cancer, Tamoxifen, Tranilast, Apoptosis, Transforming growth factor-beta Background Apoptosis or programmed cell death provides an effectivenon-inflammatory way to remove redundant or damagedcells from tissues thereby acquiring tissue homeostasis [1].Defective apoptosis and, in part, inappropriate prolifera-tion, underpin the process of tumsrcenesis [2] in addition,resistance to apoptosis is an important feature for cancercells to invasion [3].As estrogen significantly associated with the initi-ation, progression, even recurrence of breast cancer [4],anti-estrogens have important therapeutic potential inendocrine therapy for breast cancer. Tamoxifen ((Z)-1-{4-[2-(dimethylamino) ethoxy] phenyl}-1, 2-diphenyl-1-bu-tene) (TAM) is a synthetic non-steroidal anti-estrogenicdrug that widely used for the treatment or prevention of breast carcinoma [5]. Despite the relative safety and sig-nificant anti-neoplastic activities of tamoxifen, most ini-tially responsive breast tumors develop resistance to its[6]. Even though an improved understanding, resistanceto anti-estrogen therapy remains a significant clinicalproblem. However, combination therapies of tamoxifenwith other drugs that aimed at the signaling pathwaysunderlying the development of resistance may be a po-tential means of delaying the arrival of resistance.One cytokine that may contribute to the metastaticpotential and possibly tamoxifen resistance of tumor cellsis transforming growth factor beta (TGF- β ). There is threeisoforms of TGF- β : TGF- β 1,- β 2 and - β 3 [7]. Cell functions * Correspondence: aghanbari@kums.ac.ir 2 Fertility and Infertility Research Center, Kermanshah University of MedicalSciences, Kermanshah, IranFull list of author information is available at the end of the article © 2013 Darakhshan and Ghanbari; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,distribution, and reproduction in any medium, provided the srcinal work is properly cited. Darakhshan and Ghanbari  Journal of Biomedical Science  2013,  20 :76http://www.jbiomedsci.com/content/20/1/76  regulation by TGF- β s arises from his interaction with threediscrete cell surface receptors, TGF- β RI, II and III [8].TGF- β  family regulates a diverse range of epithelial cellprocesses including proliferation, apoptosis, differentiation,adhesion and migration in a cell- and context-specificmanner [9]. The multiplicity of TGF- β  actions in nearly allcell types suggests that these have a complex and pivotalrole in several physiological and pathological processes.TGF- β  have an important role in normal mammary as apotent inhibitor of epithelial proliferation and regulator of mammary growth and development [10]. In addition,TGF- β  plays complex roles in breast carcinogenesis. Early in mammary carcinogenesis the TGF- β  signaling pathway functions as a tumor suppressor [11] however, at laterstages, levels of TGF- β  increase with tumor progressionsuggesting that TGF- β  is now stimulating breast cancerprogression [12].The drug tranilast (N-[3 ′ , 4 ′ -dimethoxycinnamoyl]-anthranilic acid), an anti-allergic agent, has been appliedfor bronchial asthma, allergic rhinitis and atopic dermatitis,also suppresses collagen synthesis in keloid or hypertrophicscars [13,14]. The inhibitory effect of tranilast in different cell types is probably by antagonizing and inhibitingsynthesis and secretion of TGF- β  [15-19]. Since tranilast responsibilities through TGF- β  pathway, it seems alsotamoxifen influences this pathway [20], we hypothesizethat combination of tamoxifen and tranilast may an appro-priate therapeutic option for breast cancer management.In this paper, possible synergistic effect of tamoxifen withtranilast was examined in the hope of creating a more ef-fective anti-tumor treatment strategy. Methods Cell lines & drugs MCF-7 (noninvasive human breast adenocarsinoma, ER-and PR-positive) and MDA-MB-231 (metastatic humanbreast adenocarsinoma, ER-, PR- and HER2-negative) ob-tained from the National Cell bank of Iran (NCBI), weregrown in RPMI-1640 media supplemented with 10% (v/v)fetal calf serum (FCS) and penicillin/streptomycin antibi-otics. Cultures were maintained at 37°C in a humidifiedatmosphere of 5% CO 2  in air. TAM and tranilast werepurchased from Enzo Life Sciences and dissolved in di-methyl sulfoxide (DMSO) so that the final dimethyl sulf-oxide concentration in experimental wells did not exceed0.5% (v/v). Aliquots of a 1000  μ M stock solution of TAMand tranilast were stored in dark at  − 70°C, defrosted anddiluted with cell culture medium to the desired concentra-tion before use.The concentrations used alone treatment were the fol-lowing: TAM: 1, 2, 5, 10 and 20  μ M; tranilast: 10, 20, 50,100 and 200  μ M. The treatment combinations used were:2  μ M of TAM with different concentrations of tranilast:10, 20, 50, 100, and 200  μ M for 48 h. Cell viability measurement Cytotoxic effect of TAM and tranilast was determinedby MTT test. MCF-7 or MDA-MB-231 cells were seededin 96-well culture plates at 10 4 cells/well density. Cellswere allowed to attach for 24 h before drugs were addedto the medium. All drug concentrations were tested intriplicate wells and the assays were performed in threeseparate experiments. Following 48 h exposure at 37°Cand 5% CO 2 , 20  μ l MTT solution (Cell Growth Assay;Merck) (5 mg/ml in PBS) was added to each well and in-cubated for 4 h at 37°C. The medium with MTT wereremoved, and 100  μ l DMSO was added to dissolveformazan crystals at room temperature for 30 min. Theoptical density (OD) of each well was measured using anELISA reader at 570 nm. The percentage of cell viability was calculated according to the following equation: Cell viability   % ð Þ ¼  A 570  sample ð Þ =  A 570  control  ð Þ½   100% Lactate dehydrogenase (LDH) assay MCF-7 or MDA-MB-231 cells were cultured in 96-wellplates (1×10 4 cells/well). The plates were incubated over-night at 37°C and on the next day, 300  μ l of culturemedia containing drug doses were added to each well,and the plates were incubated at 37°C in 5% CO 2 . 48 hlater, 100  μ l of medium from each well was carefully transferred to new plates. 100  μ l of LDH substrate pre-pared according to the manufacturer ’ s procedure (Cyto-toxicity Detection Kit, Roche Chemical Co.) was addedto each well. After 20 min shaking at room temperaturelactate dehydrogenase activity was determined by changein absorbance at 490 nm. All drug concentrations weretested at least in triplicate wells and the assays were re-peated independently three times. TUNEL assay TUNEL was carried out using an In Situ Cell Death De-tection Kit, AP (Roche Diagnostics; Germany) accordingto the manufacturer ’ s instructions. Briefly, after 48 htreatment by 2  μ M TAM, 200  μ M tranilast or a combin-ation two, the cells were fixed by adding 4% paraformalde-hyde for 30 min. The fixed cells were washed in PBS,permeabilized with 0.1% Triton X-100 for 5 min on ice,and then incubated with 50  μ l of terminal deoxynucleotidyltransferase end-labeling solution for 60 min at 37°C in ahumidified chamber in the dark. Then, cells were coun-terstained in PI staining solution for 4 min at room tem-perature in the dark. The percentage of positively stainedcells per total number of cells was counted under a fluores-cence microscope at a magnification of 40 ×  in five randomfields and averaged. Darakhshan and Ghanbari  Journal of Biomedical Science  2013,  20 :76 Page 2 of 13http://www.jbiomedsci.com/content/20/1/76  Acridine orange/ethidium bromide (AO/EB) staining MCF-7 or MDA-MB-231 were plated in 24-well plates(10 5 cells/well) and incubated overnight in a humidified5% CO 2  incubator at 37°C for 24 h. At that time, cellstreated with 2  μ M TAM, 200  μ M tranilast or a combin-ation two and incubated for 48 h. After that, cells har- vested and stained with AO/EB dye mix (1 part of 100  μ g/ml of AO and 1 part of 100  μ g/ml of EB in PBS) on a cleanmicroscope slide. The live, apoptotic and necrotic cellswere observed under the fluorescent microscope at a mag-nification of 40 × . Experiments were repeated for twice. DNA gel electrophoresis (DNA laddering) The MCF-7 and MDA-MB-231 cells were grown in ab-sence or presence of 2  μ M TAM, 200  μ M tranilast andcombination of both for 48 h. Cellular DNA was thenextracted from each cell line. The cells were lysed with 1%SDS in TE buffer and digested with proteinase K for 4 h at56°C. The samples were extracted with phenol and chloro-form and the DNA was precipitated with a 1/10 volumeof 3 M sodium acetate and an equal volume of ethanol,pelleted at 13,000×g and resuspended in TE buffer and10 mg/ml of DNase-free RNase for 30 min at 37°C. Fi-nally, extracted genomic DNAs was loaded and fractionedon 2% agarose gels; gels were stained with ethidium brom-ide and photographed. When DNA extracted from apop-totic cells is subjected to gel electrophoresis, a typicalinternucleosomal  “ ladder ”  of DNA fragments is produced. Real-time quantitative PCR (RQ-PCR) analysis Total cellular RNAs were extracted from control ordrug-treated cell pellets, 48 h after treatment with 2  μ MTAM, 200  μ M tranilast and combination both, usingRNeasy Mini kit (Qiagen) in accordance with the manu-facturer ” s protocol. First strand cDNA was synthesizedusing QuantiTect Reverse Transcription Kit (Qiagen).Numbers of cDNA copies were calculated from the ab-sorbance at 260 nm. Aliquots of the cDNA were com-bined with the QuantiFast® SYBER® Green PCR MasterMix from Qiagen and primers, and assayed in triplicateusing a Rotor-Gene 6000 real-time RT-PCR. The primerswere designed using the program BioEdit and BLASTsearches (http://www.ncbi.nlm.nih.gov ) carried out to con-firm specificity of the selected nucleotide sequences andproperties of primers are summarized in Table 1.Analysis and fold differences were determined using thecomparative 2  - ΔΔ CT  method. Quantitative values wereobtained from the threshold cycle (C T ) number at whichthe increase in fluorescent signal was associated with anexponential increase of PCR product. The C T  values fromsamples were plotted on the standard curve and the copy numbers was calculated with GAPDH as the internalcontrol. Measurement of secretion of TGF- β 1 by ELISA assay The amount of TGF- β 1 released into the culture mediasupernatant of breast cancer cells was quantitated usingthe Quantikine human TGF- β 1 (R&D Systems; Minne-apolis, MN; USA) according to manufacturer ’ s guide-lines. After 1×10 5 MCF-7 and MDA-MB-231 cells wereplated onto 48-well plates, cells were treated with 2  μ MTAM, 200  μ M tranilast and a combination two for 48 h.Supernatant from conditioned medium from TAM and/or tranilast-treated cells were analyzed for TGF- β 1 pro-tein secretion by absorbance reading at 450 nm. Valuesare expressed as secreted TGF- β 1 pg/ml/1 ×10 5 cells. Wound-healing assay The post-confluent MCF-7 and MDA-MB-231 cells wereused in this experiment. Wounds with a constant diameterwere made with a plastic tip (1 mm) and wounded mono-layers were washed several times with medium to removecell debris. For each well five areas along the length of thewound were chosen accidentally for photography underphase contrast microscope on an inverted microscope.After photography, the cells were incubated at 37°C ina humidified incubator containing 5% CO 2  in mediumcontaining 2% serum in the absence or 2  μ M TAM,200  μ M tranilast and combination of both for 48 h and Table 1 Oligonucleotide primers used in real-time RT-PCRto amplify specific mRNAs together with sizes of amplified products Target mRNA Sequence (5 ′   to 3 ′  ) Productsize (bp) GAPDH Forward actctggtaagtggatattgttgc  162 Reverse ggaagatggtgatgggatttcBAX Forward tgtttgctgatggcaacttc  104 Reverse gatcagctcgggcactttagBCL-2 Forward gggatgcctttgtggaacta  138 Reverse ctcacttgtggcccaggtat TGF- β 1 Forward tgaaccggcctttcctgcttctcatg  152 Reverse gcggaagtcaatgtacagctgccgc TGF- β 2 Forward atgcggcctattgctttaga  185 Reverse taagctcaggaccctgctgt TGF- β 3 Forward cagggagaaaatccaggtca  179 Reverse cctggaaggcgtctaaccaag TGF- β R1 Forward atcacctggccttggtcctgtgg  140 Reverse ggtcctcttcatttggcactcgatg TGF- β R2 Forward gtctactccatggctctggt  197 Reverse atctggatgccctggtggtt TGF- β R3 Forward tacagagagaggtcacact  112 Reverse gtcttcagatgccacaccag Darakhshan and Ghanbari  Journal of Biomedical Science  2013,  20 :76 Page 3 of 13http://www.jbiomedsci.com/content/20/1/76  allowed to migrate. Photographs of the wound areas chosenon day 0 were again taken at 48 h. Experiments were car-ried out in triplicate. In vitro cell invasion assay Cell invasion was determined using transwell chambersmade from polycarbonate membrane filters with a poresize of 8  μ m. Transwell filters in 6-well plates were coatedwith matrigel, hydrated for about 2 h in the tissue cultureincubator with 500  μ l serum free culture media in the bot-tom and 500  μ l in the top of the chamber. After hydrationof the matrigel, 5×10 5 cells were plated in 500  μ l serum-free medium on top of chamber, while 2 ml medium 10%FCS were placed in the lower chambers. TAM at 2  μ M,tranilast at 200  μ M or a combination two were added tothe upper chambers. Cells without any drug were used as vehicle. After 48 h of incubation, the filters were removed,washed twice in PBS and fixed in 10% formalin for15 min. After fixing at room temperature, the chambersare rinsed in PBS and stained with 0.2% crystal violetstaining solution for 30 min. After washing the chambersby PBS, the cells at the top of the matrigel membranewere carefully removed by a number of cotton swabs. Atthis time all cells that remain are the ones that have in- vaded to the bottom side of the membrane. The numberof cells was counted in 10 fields at random chosen usingan inverted microscope at the 10× objective and plotted asthe percentage of invading cells. Statistical analysis Data were expressed as the mean ± standard error (SEM).Statistical analysis was conducted by using one-way ana-lysis of the variance (ANOVA) and t-test. All statisticalanalyses were done using SPSS software 19.0 (SPSS, Inc.,Chicago, IL, USA) and means were considered as statisti-cally different for P < 0.05. Results Cytotoxic and anti-proliferative effects of TAM and/ortranilast on breast cancer cells The effects of TAM and tranilast alone or in combinationon percent cell survival and proliferation was evaluated by MTT and LDH leakage assays. The results show thatTAM and/or tranilast exhibits the anti-proliferative effectin a dose-dependent manner in both MCF-7 and MDA-MB-231 cell lines (Figures 1 and 2). The percentage of  apoptotic cells in both cell lines after TAM and tranilasteither alone or combined treatment was dramatically higher than in the untreated control cells. Especially, thepercentage of apoptotic cells in the combined treatmentwas even higher than that in the treatment using the eitheragent alone (p<0.001 for each comparison). The additionof tranilast to TAM caused a synergistic antiproliferativeeffect on dysplastic cells and an additive growth inhibitioneffect in both cell lines (Figures 1 and 2). Comparing the TAM and/or tranilast effect on growth between the twocell lines yields a significantly greater effect in the MCF-7cell line than in MDA-MB-231 cell line (Figures 1 and 2). Apoptotic effects of TAM and/or tranilast on breastcancer cells We investigated whether the combination of TAM andtranilast synergistically affected apoptosis of MCF-7 andMDA-MB-231 cells. To determine the effect of TAM,tranilast or combined both on apoptosis of MCF-7 andMDA-MB-231 cells, cells was treated with 2  μ M TAM,200  μ M tranilast alone or combination two for 48 h.For analyzing apoptosis, several assays were employed,including TUNEL assay, DNA fragmentation, AO/EB stain-ing and to confirm apoptosis, we performed expression of bcl-2 and bax using real-time RT-PCR. TUNEL The TUNEL reaction (TdT-mediated deoxy-uracil nick endlabeling) is used for analyzing DNA fragmentation by label-ing the 3 ′ -OH ends of the DNA strand breaks. Thismethod is based on the ability of terminal deoxynucleotidyltransferase (TdT) to attach a fluorescein-conjugated deoxy-uracil to the 3 ′ -OH end of cut DNA [21]. Presented inFigure 2 TUNEL staining clearly displayed apoptoticcells in MCF-7 and MDA-MB-231 cells treated withTAM and tranilast alone or a combination two comparedto untreated control cells. The numbers of apoptotic cellswere quantitated and presented as percentages (Figure 3f).After treatment for 48 h, MCF-7 cells treated with TAMand tranilast alone as many as 29% and 33% of cellsdisplayed TUNEL-positive staining, respectively, whereas60% of the combination-treated cells were TUNEL-positive. As shown in Figure 3B, TAM and tranilast alsoinduce a significant apoptosis in MDA-MB-231 cells (20%and 30%, respectively) after 48 h exposure. Under the sameconditions, the percentage of TUNEL-positive MDA-MB-231 cells significantly increased with the combination of TAM and tranilast by 53%. As expected, the results show that in both MCF-7 and MDA-MB-231 cell lines, com-bination treatment resulted in higher levels of apoptosisthan either of them alone (p < 0.01). In addition, TUNELstaining revealed an increased number of apoptotic cellsin MCF-7 cells (Figure 3A) compared with MDA-MB-231 cells (Figure 3B). Acridine orange/ethidium bromide (AO/EB) staining Cell death was divided into two types, necrosis and apop-tosis. Necrosis causes inflammation while apoptosis doesnot. Induction of apoptosis in tumor cells has already beenused as an important indicator to detect the ability of che-motherapeutic drugs to inhibit tumor growth [22]. Darakhshan and Ghanbari  Journal of Biomedical Science  2013,  20 :76 Page 4 of 13http://www.jbiomedsci.com/content/20/1/76  Staining of apoptotic cells with fluorescent dyes such asAO and EB is considered the correct method for evaluatingthe changed nuclear morphology [23]. AO permeates allcells and the nuclei become green whereas EB is only takenup by cells that their cytoplasmic membrane integrity is lost,and their nuclei are stained red. EB also dominates over AO.Thus, live cells will show a normal green nucleus. Early apoptotic cells should give bright green nucleus with con-densed or fragmented chromatin. Late apoptotic cells display condensed and fragmented orange chromatin and necroticcells have a structurally normal orange nucleus [24].The type of cell death induced by TAM, tranilast andcombination of both studied by fluorescent staining forassessment of morphological changes. The Figure 4 ex-hibited morphological changes of apoptosis includingcell shrinkage and chromatin condensation as comparedto control cells. The live, apoptotic and necrotic andcells were monitored under the fluorescent microscope.From the results of Figure 4 we found that in MCF-7cells, live cells were seen in the control group, both early and late apoptotic cells are seen in the presence of 2  μ MTAM, while late apoptotic cells are obvious in the pres-ence of 200  μ M of tranilast and in the presence of com-bined treatment, the nearly all cells are late apoptoticcells (Figure 4A).In MDA-MB-231 cells, live cells with normal morph-ology were seen in the control group, whereas early apoptotic cells occurred in the group with 2  μ M TAM,early and late apoptotic cells were seen when 200  μ M of tranilast and in the presence of combination both anumber of cells in late stage, few cells also in early stage(Figure 4B). These morphological changes suggest thatcombination treatment significantly increased apoptosisin both MCF-7 and MDA-MB-231 cells. Figure 1  The effects of TAM and/or tranilast on viability in MCF-7 (A) and MDA-MB-231 (B) cells.  Cells were treated with TAM, tranilastand combination both for 48 h. Control wells were treated with equivalent amount of media alone. Treatment with TAM and tranilast combinedsignificantly decreased the viability compared with TAM or tranilast alone. The results showed the mean and SE from triplicated experiments.(*p < 0.05; **p < 0.01 ***p<0.001 compared with control). Figure 2  TAM combined with tranilast additively inhibits survival of MCF-7 (A) and MDA-MB-231 (B) cells at 48 h.  Shown are the meanvalues of three experiments ± SE. p values were determined using one-way ANOVA (*p < 0.05, **p < 0.01, ***p < 0.001 compared with control). Darakhshan and Ghanbari  Journal of Biomedical Science  2013,  20 :76 Page 5 of 13http://www.jbiomedsci.com/content/20/1/76
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x